View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21521_high_20 (Length: 228)
Name: NF21521_high_20
Description: NF21521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21521_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 1204001 - 1203879
Alignment:
| Q |
4 |
atcatcaacaacaatggttcaactcatgagatctgattctgataataatcacttcaaaaaagtcaaattggaatctcaacaagatgatgatcatcaactt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1204001 |
atcatcaacaacaatggttcaactcatgagatctgattctgataataatcacttcaaaaaagtcaaattggaatctcaacaagatgatgatcatcaactt |
1203902 |
T |
 |
| Q |
104 |
cattctaacaagcgtcccaaatt |
126 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1203901 |
cattctaacaagcgtcccaaatt |
1203879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University