View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21521_low_25 (Length: 216)
Name: NF21521_low_25
Description: NF21521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21521_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 41922120 - 41922306
Alignment:
| Q |
13 |
atgaagagagagttttaatcagtgaagtattggtgagaaataaggacggtgaggaacttgaacggaaggatctagaagcagaagccgctcaggcgcttaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41922120 |
atgaagagagagttttaatcagtgaagtattggttagaaataaggacggtgaagaacttgaacggaaggatttagaagcagaagccgctcaggcgcttaa |
41922219 |
T |
|
| Q |
113 |
agcttgtagacctaattcggctttaacggttcgtgaggtgcaagatgatgttcatcggattattaatagtggatatttttgttcgtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922220 |
agcttgtagacctaattcggctttaacggttcgtgaggtgcaagatgatgttcatcggattattaatagtggatatttttgttcgtg |
41922306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University