View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21522_high_11 (Length: 372)
Name: NF21522_high_11
Description: NF21522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21522_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 361
Target Start/End: Original strand, 42473564 - 42473906
Alignment:
| Q |
19 |
gtttggatgttggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtactcgaccaatcaccttggcttat |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
42473564 |
gtttggatgttggggataatatccgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtagtggaccaatcacctcggcttat |
42473663 |
T |
|
| Q |
119 |
gtatttcccaaaaattggtaattgttatgatttttatgaccctatgcagcgtaagactattcccttgagttgccagagttggatggatgtcgtgtttgct |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473664 |
gtatttcccaaaaattggtaatttttatgatttttatgaccctatgcagcgtaagactattcccttgagttgccagagttggatggatgtcgtgtttgct |
42473763 |
T |
|
| Q |
219 |
atgcaaaagatggttggttattgctaaaccggcatgactggcggagtttggacagagattgcattttttctctctttaatccctttactagggatctgat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473764 |
atgcaaaagatggttggttattgctaaaccggcatgactagcggaggttggacagagatcgcattttttctctctttaatccctttactagggatctgat |
42473863 |
T |
|
| Q |
319 |
cacgctgccaagctttaaaaggacataccgaaatgctgccttt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473864 |
cacgctgccaagctttaaaaggacataccgaaatgctgccttt |
42473906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 360
Target Start/End: Original strand, 42479101 - 42479443
Alignment:
| Q |
19 |
gtttggatgttggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtactcgaccaatcaccttggcttat |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479101 |
gtttggatattggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtactcgaccaatcaccttggcttat |
42479200 |
T |
|
| Q |
119 |
gtatttcccaaaaattggtaattgttatgatttttatgaccctatgcagcgtaaga-ctattcccttgagttgccagagttggatggatgtcgtgtttgc |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479201 |
gtatttcccaaaaaagggtaattgttatgatttctatgaccctgttcagcgtaagacctattcccttgagttgccagagttggatggatgtcgtgtttgc |
42479300 |
T |
|
| Q |
218 |
tatgcaaaagatggttggttattgctaaaccggcatgactggcggagtttggacagagattgcattttttctctctttaatccctttactagggatctga |
317 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||||| |||||| || || |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42479301 |
tatacaaaagatggttggttattgctaaaccggcaggactggcggaggttggacggaaatcacattttctctctctttaatccctttactagggatctga |
42479400 |
T |
|
| Q |
318 |
tcacgctgccaagctttaaaaggacataccgaaatgctgcctt |
360 |
Q |
| |
|
|||||||||||| ||| | |||||||| | || ||||||||| |
|
|
| T |
42479401 |
tcacgctgccaaaatttgacaggacatatcaaattgctgcctt |
42479443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 32 - 251
Target Start/End: Complemental strand, 26047365 - 26047145
Alignment:
| Q |
32 |
ggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtactcgaccaatcaccttggcttatgtatttcccaaaa |
131 |
Q |
| |
|
||||||| | |||||||| |||||||||||||| ||| || ||||||| | ||||||| | | |||||||||| ||| | |||||||| || ||| |
|
|
| T |
26047365 |
ggataatgtccgtgcttctgctgtttgcaagagttggaattttgttgccaatgctgtacgcatggtgaaccaatcaccatggttgatgtattttccgaaa |
26047266 |
T |
|
| Q |
132 |
attggtaattgttatgatttttatgaccctatgcagcgtaagac-tattcccttgagttgccagagttggatggatgtcgtgtttgctatgcaaaagatg |
230 |
Q |
| |
|
||||| | || ||||| || ||||||||| | ||||| ||||| |||||| ||||||| ||||||||| |||||| | | ||||| || ||||||||| |
|
|
| T |
26047265 |
tttggtcagtggtatgaattctatgaccctgttcagcggaagacctattccattgagtttccagagttgaatggatctagagtttgttacacaaaagatg |
26047166 |
T |
|
| Q |
231 |
gttggttattgctaaaccggc |
251 |
Q |
| |
|
|||||||| ||||| |||||| |
|
|
| T |
26047165 |
gttggttactgctataccggc |
26047145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University