View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21523_high_7 (Length: 237)
Name: NF21523_high_7
Description: NF21523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21523_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 155
Target Start/End: Complemental strand, 40790172 - 40790023
Alignment:
| Q |
2 |
aatatcatttttcatttaacatattatcactaatgaaatgctatatataaacaacttcgtnnnnnnnngtacgatcaaatttgttttaaagggaggaaca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||| |||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
40790172 |
aatatcatttttcatttaacatattatcactaatgaaat---at-tataaataacttcgtaaaaaaaagtacgatcaaatttgtttttaagggaggaaca |
40790077 |
T |
 |
| Q |
102 |
tttgtttggtcataaccataaaaagattcatttgagtacaatcacacaattggg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790076 |
tttgtttggtcataaccataaaaagattcatttgagtacaatcacacaattggg |
40790023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 23951161 - 23951116
Alignment:
| Q |
177 |
acttaaataacatgttatttcaaatgattaaatgattagtactttt |
222 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
23951161 |
acttaaataatatgttattttaaatgattaaatgataaatactttt |
23951116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University