View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21523_low_6 (Length: 250)
Name: NF21523_low_6
Description: NF21523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21523_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 72 - 242
Target Start/End: Original strand, 40790413 - 40790577
Alignment:
| Q |
72 |
agttactaatgatatgttcaaactatgtgagctcgattttaatagcaagtaaaaattgactatactcatctctaataatgcatacacccaaatacctaca |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40790413 |
agttactaatgatatgttcaaactatgtgagctcgattttaatagcaagtaaaaattgactatactcatctctaataatgcatacaccc-aatacctaca |
40790511 |
T |
|
| Q |
172 |
ttattacgatgagaagattaaaagaagtatcgtatcaatgtttcacttctacatgctaacaacttcttttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
40790512 |
ttattacgatgagaagattaaaagaa-----gtatcaatgttttacttctacatgctaacaactgcttttc |
40790577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University