View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21523_low_7 (Length: 237)

Name: NF21523_low_7
Description: NF21523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21523_low_7
NF21523_low_7
[»] chr2 (1 HSPs)
chr2 (2-155)||(40790023-40790172)
[»] chr7 (1 HSPs)
chr7 (177-222)||(23951116-23951161)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 155
Target Start/End: Complemental strand, 40790172 - 40790023
Alignment:
2 aatatcatttttcatttaacatattatcactaatgaaatgctatatataaacaacttcgtnnnnnnnngtacgatcaaatttgttttaaagggaggaaca 101  Q
    |||||||||||||||||||||||||||||||||||||||   || |||||| ||||||||        ||||||||||||||||||| ||||||||||||    
40790172 aatatcatttttcatttaacatattatcactaatgaaat---at-tataaataacttcgtaaaaaaaagtacgatcaaatttgtttttaagggaggaaca 40790077  T
102 tttgtttggtcataaccataaaaagattcatttgagtacaatcacacaattggg 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40790076 tttgtttggtcataaccataaaaagattcatttgagtacaatcacacaattggg 40790023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 23951161 - 23951116
Alignment:
177 acttaaataacatgttatttcaaatgattaaatgattagtactttt 222  Q
    |||||||||| ||||||||| ||||||||||||||| | |||||||    
23951161 acttaaataatatgttattttaaatgattaaatgataaatactttt 23951116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University