View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21524_high_7 (Length: 245)
Name: NF21524_high_7
Description: NF21524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21524_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 36465245 - 36465036
Alignment:
| Q |
1 |
ggtgaaggcatgattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgatttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465245 |
ggtgaaggcatgattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacacccaacacttgacctgcctgtgattgactatgatttag |
36465146 |
T |
|
| Q |
101 |
cacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465145 |
cacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatatt |
36465046 |
T |
|
| Q |
201 |
tttcacaggt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
36465045 |
tttcacaggt |
36465036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 2 - 206
Target Start/End: Complemental strand, 36474422 - 36474218
Alignment:
| Q |
2 |
gtgaaggcatgattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgatttagc |
101 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474422 |
gtgaagtcatgattactggtggagcaggagcaactgttttatacaacttgaagaaaagacacccaacacttgacctgcctgtgattgactatgatttagc |
36474323 |
T |
|
| Q |
102 |
acttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatattt |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||||| ||||| || | |||||| |
|
|
| T |
36474322 |
acttcttttccaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttgctaatcatattt |
36474223 |
T |
|
| Q |
202 |
ttcac |
206 |
Q |
| |
|
||||| |
|
|
| T |
36474222 |
ttcac |
36474218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University