View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21524_high_8 (Length: 242)
Name: NF21524_high_8
Description: NF21524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21524_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 47405085 - 47404860
Alignment:
| Q |
1 |
tattactacacttgtttctcttaattatatgcttcttgttatatgttcattaaggaacaatcgtgctcaattttcttgtctaaagataagtagatttctt |
100 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47405085 |
tattaccacacttgtttatcttaattatatgcttcttgttatatgttcattaaggaacaatcgtgctcaattttcttgtctaaagataagtagatttctt |
47404986 |
T |
|
| Q |
101 |
atagctttgagttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttctcaagaacctccaaatctt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47404985 |
atagcttcgagttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttctcaagaacctccaaatctt |
47404886 |
T |
|
| Q |
201 |
ttgctataatcgaccaacctcaaatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47404885 |
ttgctataatcgaccaacctcaaatg |
47404860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 181
Target Start/End: Complemental strand, 47404909 - 47404838
Alignment:
| Q |
110 |
agttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttc |
181 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |||||||| |||||| | |||| ||||| ||||||||| |
|
|
| T |
47404909 |
agttctcaagaacctccaaatcttttgctataatcgaccaacctcaaatgcatgaactttagctttaagttc |
47404838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University