View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21525_high_24 (Length: 319)
Name: NF21525_high_24
Description: NF21525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21525_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 43994104 - 43994316
Alignment:
| Q |
1 |
ggtgaatactttagtgtctcttgcatgttacttttcgcttcattcctttcgaaatctaatgtgaattttacgagagggcattctggcatttaaagctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43994104 |
ggtgaatactttagtgtctcttgcatgttacttttcgcttcattcctttcgaaatctaatgtgaattttacgagagggcattctggcatttaaagctgct |
43994203 |
T |
|
| Q |
101 |
agcaaaaaatttatattatttattgtcatttaatgagttttataacggccatgcaggacatcctttgtaatgactgtgatcgaaagggcacttcacgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43994204 |
agcaaaaaatttatattatttattgtcatttaatgagttttataacggccatgcaggacatcctttgtaatgactgtgatcgaaagggcacttcacgctt |
43994303 |
T |
|
| Q |
201 |
ccactgactgtat |
213 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
43994304 |
ccactggctgtat |
43994316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University