View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21525_high_25 (Length: 314)
Name: NF21525_high_25
Description: NF21525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21525_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 37483645 - 37483804
Alignment:
| Q |
1 |
cacagaccataaactctatcagtcaaacaccaaaaacaaatacaatttaagtctctgcgcaattatagagtgttttggttttagtccctgtaagnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37483645 |
cacagaccataaactctatcaatcaaacaccaaaaacaaatacaatttaagtctctgc--aattatagagtgttttggttttagtccctgtaagtttttt |
37483742 |
T |
 |
| Q |
101 |
ngtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483743 |
tgtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaatac |
37483804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 201 - 314
Target Start/End: Original strand, 37483843 - 37483955
Alignment:
| Q |
201 |
cactataattgcggaaactagaatcatgaataacactataattgcggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483843 |
cactataattgcggaaactagaatcatgaataacactataatt-cggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
37483941 |
T |
 |
| Q |
301 |
aagtgaggactatt |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37483942 |
aagtgaggactatt |
37483955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University