View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21526_high_13 (Length: 385)
Name: NF21526_high_13
Description: NF21526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21526_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 25029822 - 25029447
Alignment:
| Q |
1 |
tagctgcagccatgggacataaacggtgtctctgctgggccaaggaccagggtttt-gtgattttgtccattggaattgattccttcgtggtagtaaaat |
99 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25029822 |
tagctgcaaccatgggacataaatggtgtctctgctgggccaaggaccagggtttttgtgattttgtccattggaattgattccttcgtggtagtaaaat |
25029723 |
T |
|
| Q |
100 |
gtcttcagggtgctttaaacttagccatcactggtcacataagtttttaattgtatctggagttaaaactttgtttgaaatagctgttgtggtgtaaaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25029722 |
gtcttcagggtgctttaaacttagccatcactggtcacataagtttttaattgtatctggagttaaaactttgtttgaaatagctgttgtggtgtaaaac |
25029623 |
T |
|
| Q |
200 |
attgcttggttagcggctgtggactgtggtagattgatcgctgttggttcttgtttgaaagaaaaatcttgtgcttaagatcaaccttgtcattaatttc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25029622 |
attgcttggttagcggctgtggactgtggtagattgatcgctgttggttcttgtttgaaagaaaaatcttgtgcttaagatcaaccttttcattaatttc |
25029523 |
T |
|
| Q |
300 |
aattaacttccatcccgtttaccacacctagaagattagtcatgttttatcatgtgtcgaatttatataccttcat |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25029522 |
aattaacttccatcccgtttaccacacctagaagattagtcatgttttatcatgtgtcgaatttatataccttcat |
25029447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University