View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21526_high_23 (Length: 210)
Name: NF21526_high_23
Description: NF21526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21526_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 3966312 - 3966131
Alignment:
| Q |
15 |
aaaacatgactccaaaattaagtgatgactaaagtggaaatgctggcgtatgaataaataccaatcactgtaactctatgctatatatatgatcttgaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3966312 |
aaaacatgactccaaaattaagtgatgactaaagtggaaatgctggcgtatgaataaataccaatcactgtaactctatgctatatatatgatcttgaag |
3966213 |
T |
|
| Q |
115 |
ttgaaggcacatatgagtatgtccctatcttagcatgttggggtaattaaaaggattaaatttatcagttttttagaataat |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3966212 |
ttgagggcacatatgagtatgtccctatcttagcatgttggggtaattaaaaggattaaatttatcagttttttagaataat |
3966131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University