View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_high_28 (Length: 307)
Name: NF21527_high_28
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 96 - 289
Target Start/End: Complemental strand, 2630586 - 2630392
Alignment:
| Q |
96 |
ttaatctgaattagtcatgtcaccgagtgatttttgactttccgaaggtagattatgtcatatgctggagttgcaatctcaatctactattttacaccgg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2630586 |
ttaatctgaattagtcatgtcaccgagtgatttttgactttccgaaggtagattatgtcatatgctggagttgcaatctcaatctactcttttacaccgg |
2630487 |
T |
 |
| Q |
196 |
tggttaactttgtttttgtaatcatctatctattcttttgaaatacagccttagtggtatgggttcacaaattatgtta-tgacaattcgtattc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
2630486 |
tggttaactttgtttttgtaatcatctatctattcttttgaaatacagccttagtggtatcggttcacaaattatgttattgacaattcgtattc |
2630392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 2630760 - 2630689
Alignment:
| Q |
1 |
ttagaaccgtatgaaacataagaaaaatttacccaacaccttaacagttatatttttagccctacaaaccat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630760 |
ttagaaccgtatgaaacataagaaaaatttacccaacaccttaacagttatatttttagccctacaaaccat |
2630689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University