View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_high_40 (Length: 248)
Name: NF21527_high_40
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_high_40 |
 | |
|
| [»] scaffold0020 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 228581 - 228811
Alignment:
| Q |
1 |
tttcttctttcagttctcaagtgttttggttttaatgaaattttttgcaaatggatagaggtgattcttaactctgcaactctttcaatcaatattaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
228581 |
tttcttctttcagttctcaagtgtcttggttttaatgaaattttttgcaaatggatagaggtgattcttaactctgcaactctttcaatcaatattaatg |
228680 |
T |
|
| Q |
101 |
gcggtcaagagggttatttccattgcaagagaggggtgaggcagggggaccccctctctccccttttattttgtttggcagaagatgttttaagttggag |
200 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||| |
|
|
| T |
228681 |
gcagtcaatagggttatttccattgcaagagaggggtgaggcagggggaccccctctctccccttttattttgtctggcagaagatgttttaaataggag |
228780 |
T |
|
| Q |
201 |
tatctcaaaattagtggaggagggaaagctt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
228781 |
tatctcaaaattagtggaggagggaaagctt |
228811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 112 - 221
Target Start/End: Complemental strand, 16011873 - 16011764
Alignment:
| Q |
112 |
ggttatttccattgcaagagaggggtgaggcagggggaccccctctctccccttttattttgtttggcagaagatgttttaagttggagtatctcaaaat |
211 |
Q |
| |
|
||||||||| |||||| || || ||||| ||||| ||||| || ||||||||||||||||| ||||||||||||||| ||||| | ||||| |||| | |
|
|
| T |
16011873 |
ggttatttcaattgcacaaggggagtgagacagggagaccctctatctccccttttattttgcttggcagaagatgttctaagtagaagtatttcaagac |
16011774 |
T |
|
| Q |
212 |
tagtggagga |
221 |
Q |
| |
|
| |||||||| |
|
|
| T |
16011773 |
ttgtggagga |
16011764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 188
Target Start/End: Original strand, 128101 - 128159
Alignment:
| Q |
130 |
agaggggtgaggcagggggaccccctctctccccttttattttgtttggcagaagatgt |
188 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
128101 |
agaggtgtgaggcagggtgaccccctatctccacttctcttttgtttggcagaagatgt |
128159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 195
Target Start/End: Complemental strand, 32249178 - 32249116
Alignment:
| Q |
133 |
ggggtgaggcagggggaccccctctctccccttttattttgtttggcagaagatgttttaagt |
195 |
Q |
| |
|
|||||||||||||| |||||||| ||||| || | ||||||||||| ||||||||||||||| |
|
|
| T |
32249178 |
ggggtgaggcagggagaccccctatctcctctactcttttgtttggctgaagatgttttaagt |
32249116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 28337486 - 28337449
Alignment:
| Q |
19 |
aagtgttttggttttaatgaaattttttgcaaatggat |
56 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28337486 |
aagtgttttggttttaatgatattttttgcaaatggat |
28337449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 189
Target Start/End: Complemental strand, 13321038 - 13320979
Alignment:
| Q |
130 |
agaggggtgaggcagggggaccccctctctccccttttattttgtttggcagaagatgtt |
189 |
Q |
| |
|
||||| ||||||||||| |||||||| || ||| || |||||||| |||||||||||||| |
|
|
| T |
13321038 |
agaggagtgaggcagggtgaccccctatcgcccattctattttgtctggcagaagatgtt |
13320979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University