View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_low_15 (Length: 411)
Name: NF21527_low_15
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 19 - 380
Target Start/End: Original strand, 34881486 - 34881850
Alignment:
| Q |
19 |
gagatcctctatgcccataccagcgatatcccttgatcttctcccagatcctcggtttgttattgttttct---tcttctcttgcaacattagtattttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
34881486 |
gagatcctctatgcccataccagcgatatcccttgatcttcttccagatcctcggcttgttatcgttttcttcttcttctcttgcaacattagtattttc |
34881585 |
T |
|
| Q |
116 |
tcttcaatgctgttttttgcaatcagtctaacaattttcacttcttctttctgtccaatgcggtggacacgatccattgcttgttcttcaacagcagggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881586 |
tcttcaatgctgttttttgcaatcagtctaacaattttcacttcttctttctgtccaatgcggtggacacgatccattgcttgttcttcaacagcagggt |
34881685 |
T |
|
| Q |
216 |
tccaccatggctccattaagtacactctggaggcagcagtaagatttattcctgtacttgaagctctgagacttgcaagcagaatcattggctcatcaac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881686 |
tccaccatggctccattaagtacactctggaggcagcagtaagatttattcctgtacttgaagctctgagacttgcaagcagaatcattggctcatcaac |
34881785 |
T |
|
| Q |
316 |
ttccgagagttgaaattgttcaataacttgagccctttgtttggcattcattgtcccatcaagac |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881786 |
ttccgagagttgaaattgttcaataacttgagccctttgtttggcattcattgtcccatcaagac |
34881850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University