View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_low_30 (Length: 302)
Name: NF21527_low_30
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 33440751 - 33440485
Alignment:
| Q |
20 |
agtttctctggactatacaatgctggtgtgaggtttggagtatcagcatcccaccatccagctgttcccctttgtgcaccattgatgaacaaaagttgtc |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33440751 |
agtttctctggattatacaatgctggtgtgaggtttggagtatcagcatcccaccatccagctgttcccctttgtgcaccattgatgaacaaaagttgtc |
33440652 |
T |
|
| Q |
120 |
catttgggaggattatacaatctcccattattctccttgatggcatgtcttcagtttcccatctcgcgatttgatccgtgagtaccatcctgatttataa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33440651 |
catttgggaggattatacaatctcccattattctccttgatggcatgtcttcagtttcccatctcgcgatttgatctgtgattaccatcctgatttataa |
33440552 |
T |
|
| Q |
220 |
aaacaaaatgttagaatctaagaaacactggacacgacactgatatcaataaatttaagtaatcaca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33440551 |
aaacaaaatgttagaatctaagaaacactggacacgacactgatatcaataaatttaagtaatcaca |
33440485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 62 - 165
Target Start/End: Complemental strand, 43343880 - 43343777
Alignment:
| Q |
62 |
tcagcatcccaccatccagctgttcccctttgtgcaccattgatgaacaaaagttgtccatttgggaggattatacaatctcccattattctccttgatg |
161 |
Q |
| |
|
||||||||||||||| ||| ||| || ||||||||||||||||||||| |||| ||||||||||||||| | | ||||||||| |||||||||||| |
|
|
| T |
43343880 |
tcagcatcccaccatgcagatgtaccgtattgtgcaccattgatgaacaatagttctccatttgggaggataagagcatctcccatggttctccttgatg |
43343781 |
T |
|
| Q |
162 |
gcat |
165 |
Q |
| |
|
|||| |
|
|
| T |
43343780 |
gcat |
43343777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University