View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_low_31 (Length: 301)
Name: NF21527_low_31
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 10 - 301
Target Start/End: Complemental strand, 32572497 - 32572206
Alignment:
| Q |
10 |
attattcttgggaccgggttcatgcatgtactccctgattcgtacgagatgttgtggagtgattgtttggatgagaaaccatggcgcgagtttccctttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
32572497 |
attattcttgggaccgggttcatgcatgtactccctgattcgtacgagatgttgtggagtgattgtttagatgagaaaccatggcacgagtttccctttt |
32572398 |
T |
 |
| Q |
110 |
cgggacttgtggctatgttctccgcggtggtcacaatgatggtcgattctatagctactagttattatagtaagaagggtaagagcggagttgtgattcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572397 |
cgggacttgtggctatgttctccgcggtggtcacaatgatggtcgattctatagctactagttattatagtaagaagggtaagagcggagttgtgattcc |
32572298 |
T |
 |
| Q |
210 |
agagagccatggtggagatgatcaagagattggacattcacatggtggtcaccatcatattcataatgggttcaagacagatgaaagtgacg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32572297 |
agagagccatggtggagatgatcaagagattggacattcacatggtggtcaccatcatattcataatgggttcaagacagaagaaagtgacg |
32572206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University