View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_low_37 (Length: 264)
Name: NF21527_low_37
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 248
Target Start/End: Original strand, 14275141 - 14275372
Alignment:
| Q |
17 |
atatttattttctttgtgatttacgcattatttgactaattaccttgaatacttctgatagcaccgcacctcctaactagaatggagcaggaaaatgata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
14275141 |
atatttattttctttgtgatttacgcattatttgactaattaccttgaatacttctgattgcaccgcacctcctagctagagtggagcaggaaaatgata |
14275240 |
T |
 |
| Q |
117 |
caaaatttcatcaatgagagttgttactgtattgtcttggcagcttatatcaatttgatgtaaacatcaatgaatgttgacatagactatgaatattctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14275241 |
caaaatttcatcaatgagagttgttactatattgtcttggcagcttataccaatttgatttaaacatcaatgaatgttgacatagactatgaatattttg |
14275340 |
T |
 |
| Q |
217 |
aggctaacacttaaaatcccaaatattttcat |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
14275341 |
aggctaacacttaaaatctcaaatattttcat |
14275372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 168
Target Start/End: Original strand, 14268472 - 14268539
Alignment:
| Q |
101 |
gagcaggaaaatgatacaaaatttcatcaatgagagttgttactgtattgtcttggcagcttatatca |
168 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||| |||||| |||||| ||||||||| |
|
|
| T |
14268472 |
gagcaggaaaatgaagcaaaatttcatcaattagagttgtcactatattgtattggcatcttatatca |
14268539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University