View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21527_low_38 (Length: 252)
Name: NF21527_low_38
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21527_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 92 - 231
Target Start/End: Complemental strand, 40243334 - 40243184
Alignment:
| Q |
92 |
tattcattcattttgtaattggtaaacacatacagttattcagagaatccaaaattgatatttcaacaccat-----------taattatctcaataatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
40243334 |
tattcattcattttgtaattggtaaacacatacagttattcagagaatccaaaattgatatttcaacaccattatttattgactaattatctctataatt |
40243235 |
T |
|
| Q |
181 |
atttgtttcgtgtatctgtaaatttcattctttttaataagtctagtgctc |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40243234 |
atttgtttcgtgtacctgtaaatttcattctttttaataagtctagtgctc |
40243184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University