View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21527_low_54 (Length: 204)

Name: NF21527_low_54
Description: NF21527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21527_low_54
NF21527_low_54
[»] chr2 (1 HSPs)
chr2 (18-187)||(4007599-4007768)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 4007768 - 4007599
Alignment:
18 agttttctcatatggattacgtacattttaatctctagtagaatatggatagtttcttttctctcacacacacattggaagaattgcaactgctcataga 117  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4007768 agttttctcatatggactacgtacattttaatctctagtagaatatggatagtttcttttctctcacacacacattggaagaattgcaactgctcataga 4007669  T
118 ctcattgtcaaatgcatatgcaagtaattttatattcaaatatctgcactcatagttattataggttcat 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
4007668 ctcattgtcaaatgcatatgcaagtaattttatattcaaatatctgcactcataattattataggttcat 4007599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University