View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21528_high_9 (Length: 237)
Name: NF21528_high_9
Description: NF21528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21528_high_9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 86 - 237
Target Start/End: Original strand, 41864690 - 41864841
Alignment:
| Q |
86 |
ctcaataaatgaactcaactatattgcttccaaaaggggatggttcaagttggtggctccaagcttgtgtttcttcgtaaacaaattattcaaacccact |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
41864690 |
ctcaataaatgaactcaactatattgcttccaaaaggggatggttcaagttggtggttccaagcttgtgtttcttcgtaaacaaattattcagcccctct |
41864789 |
T |
|
| Q |
186 |
cttttttgtgctccttagccccgccattcaacttcatttgattccactttat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41864790 |
cttttttgtgctccttagccccgccattcaacttcatttgtttccactttat |
41864841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Original strand, 41864594 - 41864624
Alignment:
| Q |
17 |
agagttaacattcatacgaagggttctttat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41864594 |
agagttaacattcatacgaagggttctttat |
41864624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 237
Target Start/End: Complemental strand, 26451987 - 26451952
Alignment:
| Q |
202 |
agccccgccattcaacttcatttgattccactttat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26451987 |
agccccgccattcaacttcatttgattccactttat |
26451952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University