View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21528_low_11 (Length: 229)
Name: NF21528_low_11
Description: NF21528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21528_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 41866259 - 41866123
Alignment:
| Q |
1 |
ataactgcttgcaataccatccttgtacgtttgaattttactcttttccattctatccaatgtgaaatcaatttgtgtatctttttatctctctattgct |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
41866259 |
ataactgcttgcaataccatccctgtacgtttgaattttactcttttccattctatccaatgtgaaaacagtttgtgtatctttttatctctctattgct |
41866160 |
T |
 |
| Q |
101 |
accaccattttgcttctgttctaagccattatttcat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41866159 |
accaccattttgcttctgttctaagccattatttcat |
41866123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 131 - 229
Target Start/End: Complemental strand, 41866083 - 41865985
Alignment:
| Q |
131 |
atttcattctttatttttcttcatattttataagccttactagccttatttgaactttgtggcaaatactcattgatttgaatacttcaacaatttttt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41866083 |
atttcattctttatttttcttcatattttattagccttattagccttatttgaactttgtggcaaatactcattgatttgaatacttcaacaatttttt |
41865985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University