View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21528_low_6 (Length: 293)
Name: NF21528_low_6
Description: NF21528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21528_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 5250181 - 5250019
Alignment:
| Q |
18 |
atgaacaatcacaacatcactcacatcaatcttaaatcacttccaatggatccaactatttggagcaaattaccacctgaaattcttgaatacatccttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5250181 |
atgaacaatcacaacatcactcacatcaatcttaaatcacttccaatggatccaactatttggagcaaattaccacctgaaattcttgaatacatccttt |
5250082 |
T |
|
| Q |
118 |
cttttcttcctctcaaaaccttcatgtctctaagatcaacttgcaaaggtttttggccattga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5250081 |
cttttcttcctctcaaaaccttcatgtctctaagatcaacttgcaaaggtttttggccattga |
5250019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University