View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21528_low_8 (Length: 283)
Name: NF21528_low_8
Description: NF21528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21528_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 271
Target Start/End: Original strand, 34880273 - 34880530
Alignment:
| Q |
14 |
atgtcatttccactttgtgagtagttgtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880273 |
atgtcatttccactttgtgagtagttgtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctcc |
34880372 |
T |
|
| Q |
114 |
atttgacccaacaatttttgtgacttccttttgtgaaaattgacttccgaacctagcatcatttcgaatcctctcaataatgctttcaatgtccaaaatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880373 |
atttgacccaacaatttttgtgacttccttttgtgaaaattgacttccgaccctgacaccatttggaatcctctcaataatgctttcaatgtccaaaatt |
34880472 |
T |
|
| Q |
214 |
atccaccattggctcccatatacatagagtatcatcgacgtattgcaaatgccatatt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34880473 |
atccaccattggctcccatatacatagagtatcatcgacgtattgcaaatgcgatatt |
34880530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 90 - 127
Target Start/End: Complemental strand, 36988012 - 36987975
Alignment:
| Q |
90 |
ttcttggttggcaaaccttcctccatttgacccaacaa |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36988012 |
ttctaggttggcaaaccttcctccatttcacccaacaa |
36987975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University