View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21528_low_9 (Length: 251)
Name: NF21528_low_9
Description: NF21528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21528_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 34880254 - 34880059
Alignment:
| Q |
1 |
tctctttcaaagcaagttttgatggagaagtatggtgagcaaattgaaggtttggaactggtggtaggagcaaaatagttgaggtttacatcgttgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880254 |
tctctttcaaagcaagttttgatggagaagtatggtgagcaaattgaaggtttggaactggtggtaggagcaaaatagttgaggtttacatcgttgtgtt |
34880155 |
T |
|
| Q |
101 |
ggaaggatttgatcctattggatgggagtgtgggggatgattagttcacaaatagggtgttgagaaaagtgggcaatggcaggaagactaattttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34880154 |
ggaaggatttgatcctattggatgggagtgtgggggatgattagtttacaaatagggtgttgagaaaagtgggcaatggctggaagactaattttt |
34880059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 197 - 234
Target Start/End: Complemental strand, 34879978 - 34879941
Alignment:
| Q |
197 |
aaggttggggacttgtggagaattcatgattgagtggt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34879978 |
aaggttggggacttgtggagaattcatgattgagtggt |
34879941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University