View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21529_high_7 (Length: 316)
Name: NF21529_high_7
Description: NF21529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21529_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 38558664 - 38558952
Alignment:
| Q |
18 |
attgaagatgttgaggtgccagcaataatggttgccattttccttgaatgtcgattcaggtttcagaccagactcttgcttatttcagacagatgggcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38558664 |
attgaagatgttgaggtgccagcaataatggttgccattttccttgaatgtcgattcaggtttcagaccagactcttgcttatttcagacaaatgggcaa |
38558763 |
T |
 |
| Q |
118 |
atatgttgtaatattagttattagaattggtgcattgtcaacctatgcaccacacagcgtggatagaatgaaaaatgaaacccgttgtgacgttgttagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38558764 |
atatgttgtaatattagttattagaattggtgcattgtcaacctatgcaccacacagcgtggatagaatgaaaaatgaaacccgttgtgacgttgttagt |
38558863 |
T |
 |
| Q |
218 |
tatccatatttgcataatacccaatggattttatccacgtgtcacatactatgtgtggtgcccaataatacatcacttgcactacctttg |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38558864 |
tatccatatttgcat-atacccaatggattttatccacgtgtcacatactatgtgtggtgcctaataatacatcacttgcactacctttg |
38558952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University