View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21529_high_9 (Length: 305)
Name: NF21529_high_9
Description: NF21529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21529_high_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 7 - 305
Target Start/End: Complemental strand, 2115412 - 2115114
Alignment:
| Q |
7 |
cctgctaccaccaactccaaacttggaagctgtgatgtctacattggatttcatggacaaaatccgaatcttattcgcttctgcaagtggcttaaatctg |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2115412 |
cctgctaccactaactccaaacttggaagctgtgatgtctacattggattccatggacaaaatccgagtcttattcgcttctgcaagtggcttaaatctg |
2115313 |
T |
|
| Q |
107 |
agcttgagcttcaaggcattgattgtttacttgctgatagatcaaagtattcagatattcaaagccatgaaattgctgatagagtcatttgctcggtcgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115312 |
agcttgagcttcaaggcattgattgtttgcttgctgatagatcaaagtattcagatattcaaagccatgaaattgctgatagagtcatttgctcggtcgc |
2115213 |
T |
|
| Q |
207 |
gtttggtttggtgatcgtcacaagttcaagtttcctcaaccgtttaagcatggaagaggtgagattctttgctcaaaagaagaacttgattccgatatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115212 |
gtttggtttggtgatcgtcacaagttcaagtttcctcaaccgtttaagcatggaagaggtgagattctttgctcaaaagaagaacttgattccgatatt |
2115114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University