View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21529_low_14 (Length: 233)
Name: NF21529_low_14
Description: NF21529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21529_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 40189713 - 40189513
Alignment:
| Q |
18 |
atacactaggaaaaaacaaaatctaaaagtgacaagatctttagattcacagagaatttaacaaaatcacaatgacaccgtaattttgacaaaaactata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189713 |
atacactaggaaaaaacaaaatctaaaagtgacaagatctttagattcagagcgaatttaacgaaatcacaatgacaccgtaattttgacaaaaactata |
40189614 |
T |
|
| Q |
118 |
ttttggaccgtccgcaaaatcatcgtgtgaatccaaatgttcacatagtatcattcttaccttgtcttccttttctgctttggccttctttcttgcaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189613 |
ttttggaccgtccgcaaaatcatcgtgtgaatccaaatgttcacatagtatcattcttaccttgtcttccttttctgctttggccttctttcttgcaact |
40189514 |
T |
|
| Q |
218 |
g |
218 |
Q |
| |
|
| |
|
|
| T |
40189513 |
g |
40189513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 113
Target Start/End: Original strand, 2578008 - 2578052
Alignment:
| Q |
71 |
gaatttaacaaaatcacaatgacacc--gtaattttgacaaaaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
2578008 |
gaatttaacaaaatcacaatgacaccgtgtgattttgacaaaaac |
2578052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University