View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21529_low_16 (Length: 217)
Name: NF21529_low_16
Description: NF21529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21529_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 44622534 - 44622355
Alignment:
| Q |
22 |
ccaaacagcagctatatcattgtagcatagcagaatttgaacaagcttctattttacataatatgcgattgacaacactgcttttttatcccgctattcc |
121 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44622534 |
ccaaacagcagctatagcattgtagcatagcagaatttgaacaagcttctattttacataatatgcgattgacaacactgcttttttataccgctattcc |
44622435 |
T |
|
| Q |
122 |
tttagctcgtgatgaacctaagattgtcatttttgctgtttgatatcagttgtattttatgtccaatctcacaggatatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44622434 |
tttagctcgtgatgaacctaagattgtcatttttgctgtttgatatcagttgcattttatgtccaatctcacaggatatt |
44622355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 34925332 - 34925253
Alignment:
| Q |
18 |
gttgccaaacagcagctatatcattgtagcatagcagaatttgaacaagcttctattttacataatatgcgattgacaac |
97 |
Q |
| |
|
|||| |||| ||| |||||| ||||||||||||||||||||||||||| || ||||||| || || ||| ||||||||| |
|
|
| T |
34925332 |
gttgtcaaatagcggctatagcattgtagcatagcagaatttgaacaaactgctattttccacgatctgcaattgacaac |
34925253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 8558849 - 8558804
Alignment:
| Q |
31 |
agctatatcattgtagcatagcagaatttgaacaagcttctatttt |
76 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
8558849 |
agctataacattgtagcatagcggaatttgaacaaactactatttt |
8558804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 32 - 101
Target Start/End: Original strand, 38434183 - 38434252
Alignment:
| Q |
32 |
gctatatcattgtagcatagcagaatttgaacaagcttctattttacataatatgcgattgacaacactg |
101 |
Q |
| |
|
|||||| || |||| ||||||||||||||||||| || ||||||| | | | ||||||||||||||||| |
|
|
| T |
38434183 |
gctatagcactgtaacatagcagaatttgaacaaactgctattttccgtgttctgcgattgacaacactg |
38434252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University