View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2152_high_3 (Length: 214)
Name: NF2152_high_3
Description: NF2152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2152_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 37597953 - 37597777
Alignment:
| Q |
18 |
agaacctgcaaatgctaattattcagattaactaaaatgattatttccttgattaattgaaacaagtaattaggtgaatttgaagaaatgaagatatgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597953 |
agaacctgcaaatgctaattattcagattaactaaaatgattatttccttgattaattgaaacaagtaattaggtgaatttgaagaaatgaagatatgct |
37597854 |
T |
 |
| Q |
118 |
catacatacatacatacatacctgtctgtgtgaaaatgttttggttagttttcttacaataccctgcatctcccttttgtgttca |
202 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37597853 |
catacatac--------atacctgtctgtgtgaaaatgttttggttagttttcttacaataccctgcatctctcttttgtgttca |
37597777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 126
Target Start/End: Original strand, 93981 - 94026
Alignment:
| Q |
81 |
aagtaattaggtgaatttgaagaaatgaagatatgctcatacatac |
126 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
93981 |
aagtaatcaggtgcatttgaagaaatgaagatatggacatacatac |
94026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University