View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2152_high_4 (Length: 203)
Name: NF2152_high_4
Description: NF2152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2152_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 185
Target Start/End: Original strand, 12131515 - 12131688
Alignment:
| Q |
12 |
gagatgaatgagaagagtactgttctgtttaaagctttgcaaccattttacaagggatgacggcacattaatagcatttgcagtatcaggatcattttca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12131515 |
gagatgaatgagaagagtactgttctgtttaaagctttgcaaccattttacgagggatgacggcacattaatagcatttgcagtatcaggatcattttca |
12131614 |
T |
 |
| Q |
112 |
caagcacgaggcaccgagatggcagcacaattgacaaccacatcaggctgccattaacaaacaaacagagaatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12131615 |
caagcacgaggcaccgagatggcagcacaattgacaaccacatcaggctgccattaacaaacaaacagagaatt |
12131688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 145
Target Start/End: Original strand, 24403622 - 24403745
Alignment:
| Q |
23 |
gaagagtactgttctgtttaaagctttgcaaccattttacaagg---gatgacggcacattaatagcatttgcagtatcaggatcattttcacaagcacg |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| ||||| || |||| ||||||| || |||||| ||||| ||||||||||| | |
|
|
| T |
24403622 |
gaagagtactgttctgtttaaggctttgcagccattttacaagggacgatgatggtacatcgatagcatgtgtagtatc-ggatcgatttcacaagcatg |
24403720 |
T |
 |
| Q |
120 |
aggcaccgagatggcagcacaattga |
145 |
Q |
| |
|
||| || || |||||||||||||||| |
|
|
| T |
24403721 |
aggaacaga-atggcagcacaattga |
24403745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University