View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21530_high_14 (Length: 203)
Name: NF21530_high_14
Description: NF21530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21530_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 21261857 - 21261746
Alignment:
| Q |
17 |
aatggtaatatatttatttatcacttttatgcaattttatgtgttttatcaactgaaattgagtatctgtatatgaa------caggtattgtggagtcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
21261857 |
aatggtaatatatttatttatcacttttatgcaattttatgtgttttatcaactaaaattgaatatctgtatatgaaaatttgcaggtattgtggagtcc |
21261758 |
T |
 |
| Q |
111 |
ttgaagaatagt |
122 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
21261757 |
ttaaagaatagt |
21261746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 118 - 185
Target Start/End: Complemental strand, 21261672 - 21261605
Alignment:
| Q |
118 |
atagtttgatgacaattgttttggtagttaattattattgtcattctggtgctataaagtggaagata |
185 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21261672 |
atagtttgatgacaattgttttggtaattaattattattgtcattctggtgctataaagtgaaagata |
21261605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 20 - 118
Target Start/End: Complemental strand, 22018606 - 22018502
Alignment:
| Q |
20 |
ggtaatatatttatttatcacttttatgcaattttatgtgttttatcaactgaaattgagtatctgtatatgaa------caggtattgtggagtccttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
22018606 |
ggtaatatatttatttatcacttttatgcaaattcatgtgttttatcaagtgaaattgagtatctttatatgaaattttgcaggtattgtggagtccttg |
22018507 |
T |
 |
| Q |
114 |
aagaa |
118 |
Q |
| |
|
||||| |
|
|
| T |
22018506 |
aagaa |
22018502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University