View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21530_high_8 (Length: 275)
Name: NF21530_high_8
Description: NF21530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21530_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 10604873 - 10604618
Alignment:
| Q |
1 |
ttatttgtctaaattaatcatgctataaaatatgaaacaaaagtacaccttttctatcattctttttctatgctagctataatattttaatttaatgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604873 |
ttatttgtctaaattaatcatgctataaaatatcaaacaaaagtacatcttttctatcattctttttctatgctagctataatattttaatttaatgttt |
10604774 |
T |
|
| Q |
101 |
attgatcatcaacttattatgttttgttgcatcttcttttacagaaaaattaggccaaagatgacactccctatctttttgaggctagcggttcttggtt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604773 |
attgatcatcaacttatactgttttgttgcatcttcttttacagaaaaattaggccaaagatgacactccctatctttttgaggctagcggttcttggtt |
10604674 |
T |
|
| Q |
201 |
tccttgagtaaggctcttcaattcctctcctccatttaattatcactatattcttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604673 |
tccttgagtaaggctcttcaattcctctcctccatttaattatcactatattcttg |
10604618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 138 - 219
Target Start/End: Complemental strand, 32604369 - 32604288
Alignment:
| Q |
138 |
tttacagaaaaattaggccaaagatgacactccctatctttttgaggctagcggttcttggtttccttgagtaaggctcttc |
219 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||| ||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
32604369 |
tttacagaaaaacaaggccaaagatgactctccccatcttcctgaggatagtggcacttggtttccttgagtaaggctcttc |
32604288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University