View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21532_high_16 (Length: 250)
Name: NF21532_high_16
Description: NF21532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21532_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 24 - 234
Target Start/End: Complemental strand, 52086810 - 52086600
Alignment:
| Q |
24 |
tatgttggttgatctttattaaattggttgagtggcaatattcatgatttggtactttagctactttcagcgtgcactgtgtacttccttttattaacat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52086810 |
tatgttggttgatctttattaaattggttgagtggcaatattcatgatttggtactttagctactttcagcgtgcactgtgtacttccttttattaatat |
52086711 |
T |
 |
| Q |
124 |
cttgttgaaattatgtaatatttcaaaattttcattcttctttttagcatcatgtgcttaagcaagttaattccataaatatttatgtagtgaaatattg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52086710 |
cttgttgaaattatgtaatatttcaaaattttcattcttctttttagcatcatgtgcttaagcaagttaattccataaatatttctgtagtgaaatattg |
52086611 |
T |
 |
| Q |
224 |
atgatgttctt |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
52086610 |
atgatgttctt |
52086600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University