View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21532_high_23 (Length: 233)
Name: NF21532_high_23
Description: NF21532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21532_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 5704866 - 5704647
Alignment:
| Q |
1 |
gtttgaatgacaaattcattcactttatttgcattgacctctcatgaagcatgttgtaatgacctcaatggtgaggagagataaaaatgggtggtgaatc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5704866 |
gttttaatgacaaattcattcactttatttgcattgacctctcatgaagcatgttgtaatgacctcaatggtgaggagagataaaaatgggtggtgaatc |
5704767 |
T |
 |
| Q |
101 |
catttctcccaagcgtagatggttattnnnnnnnnnttacatcaggggagttccattcccattt--aaagaaatgtcttgttaatgagtgtctctaaaac |
198 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| || | |
|
|
| T |
5704766 |
cacttctcccaagcgtagatggttatt-aaaaaaaattacatcaggggagttccattcccatttaaaaaaaaatgtcttgttaatgagtgtcttcgaagc |
5704668 |
T |
 |
| Q |
199 |
actctttaaacatgctaaatt |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5704667 |
actctttaaacatgctaaatt |
5704647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 26700219 - 26700264
Alignment:
| Q |
173 |
gtcttgttaatgagtgtctctaaaacactctttaaacatgctaaat |
218 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
26700219 |
gtcttgttaatgagtgtctctgaaatactctttaaacatactaaat |
26700264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University