View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21532_high_8 (Length: 316)
Name: NF21532_high_8
Description: NF21532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21532_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 308
Target Start/End: Original strand, 4690899 - 4691191
Alignment:
| Q |
16 |
ttctcaacacaaaatgaagaaaattttgcattgcaacaaagttttatatttctaagatattttgaagcctctcaaatctaaaagcaatcataactatttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4690899 |
ttctcaacacaaaatgaagaaaattttgcattgcaacaaggttt-atatttctaagatattttgaagcctctcaaatctaaaagcaatcataactatttt |
4690997 |
T |
|
| Q |
116 |
atattattctatttccatttaaagataaaggttttcctttccnnnnnnnnnn-tttacaaattagtttttgcactccccaaaattcccactagtctttat |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4690998 |
atattattctatttccattcaaagataaaggttttccttaccaaaaaaatatatttacaaattagtttttgcactccccaaaattcccactagtctttat |
4691097 |
T |
|
| Q |
215 |
ttgatgaccatttatatcaccatgagaattttcctagagtgagcaattgcatgaaagctttcgaagcgagaatcataaaatcaaatcaaagtat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
4691098 |
ttgatgaccatttatatcaccatgagaattttcctagagtgagcaattgcatgaaagcttttgaagagagaatcataaaatcaaatcaaagtat |
4691191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University