View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21534_low_11 (Length: 232)
Name: NF21534_low_11
Description: NF21534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21534_low_11 |
 |  |
|
| [»] scaffold0018 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 170 - 210
Target Start/End: Complemental strand, 184918 - 184878
Alignment:
| Q |
170 |
aacaaaacacttgcactttctcgacctattgggacacttta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
184918 |
aacaaaacacttgcactttctcgacctattgggacacttta |
184878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 83 - 116
Target Start/End: Original strand, 185119 - 185152
Alignment:
| Q |
83 |
tgtgaatgattacattatatggtaaacatgtcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
185119 |
tgtgaatgattacattatatggtaaacatgtcat |
185152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University