View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21534_low_8 (Length: 299)
Name: NF21534_low_8
Description: NF21534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21534_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 36 - 282
Target Start/End: Complemental strand, 45345960 - 45345710
Alignment:
| Q |
36 |
gtgtactcttaagggcatggcatattcttatcatgggaagtgggaacgattcaattcgaaccaaccattttctcagcaagaaatgtgattgcat----tt |
131 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45345960 |
gtgtaatcttaagggcatggcatattcttatcatgggaagtgggaaccattcaattcgaaccaaccattttctcagcaagaaatgtgattgcatgcattt |
45345861 |
T |
 |
| Q |
132 |
tcatgtacacaagcacaacacatcacaaacatacaaacaactaacttcatttatatgctgctacaaccacataacaggatttatcatctttgtctacaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345860 |
tcatgtacacaagcacaacacatcacaaacatacaaacaactaacttcatttatatgctgctacaaccacataacaggatttatcatctttgtctacaaa |
45345761 |
T |
 |
| Q |
232 |
tctttaggattgtatcgtagtcaatttttccatcctttcctatttttgttc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345760 |
tctttaggattgtatcgtagtcaatttttccatcctttcctatttttgttc |
45345710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University