View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21534_low_9 (Length: 261)
Name: NF21534_low_9
Description: NF21534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21534_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 89 - 256
Target Start/End: Complemental strand, 43170640 - 43170473
Alignment:
| Q |
89 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagactggggtagaactg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43170640 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagattggggtagaactg |
43170541 |
T |
|
| Q |
189 |
gtgtcctttccatagcactcaatgatacagttgttctttgtagtgattccgatggttcctatgcttct |
256 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
43170540 |
gtgtcctttccatagcactcaatgatatagttgttctttgtagtgattccgatggtttctatgattct |
43170473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 89 - 256
Target Start/End: Original strand, 43217696 - 43217863
Alignment:
| Q |
89 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagactggggtagaactg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43217696 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagattggggtagaactg |
43217795 |
T |
|
| Q |
189 |
gtgtcctttccatagcactcaatgatacagttgttctttgtagtgattccgatggttcctatgcttct |
256 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
43217796 |
gtgtcctttccatagcactcaatgatattgttgttctttgtagtgattccgatggtttctatgattct |
43217863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 43217466 - 43217522
Alignment:
| Q |
21 |
catgtcgtagttgtaatatttattt-gtccattctacataccataaggactaatttt |
76 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
43217466 |
catgtcgtagttgtaatatttattttgtccattctacatacaataaggactaatttt |
43217522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University