View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21535_high_5 (Length: 248)
Name: NF21535_high_5
Description: NF21535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21535_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 37566126 - 37565911
Alignment:
| Q |
19 |
gcaacatctgaaaaatgtaattgacatttctccttacttgtcgtcttccatannnnnnnnaattgattcagagggtaaaataaaagataacagaaataaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37566126 |
gcaacatctgaaaaatgtaattgacatttctcctt----gtcgtcttccatattttttttaattgattcagagggtaaaataaaagataacagaaataaa |
37566031 |
T |
 |
| Q |
119 |
ctacaaaatcatcttagtcatgccacacacatacaatagaggccaagcaaggggg---cagtcccaaagctgcagctaagaagatgataagacaccttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37566030 |
ctacaaaatcatcttagtcatgccacacacatacaatagaggccaagcaagggggcaacagtcccaaagctgcagccaagaagatgataagacaccttct |
37565931 |
T |
 |
| Q |
216 |
tagcaagtcaatccgcacct |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37565930 |
tagcaagtcaatccgcacct |
37565911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University