View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21535_high_6 (Length: 240)
Name: NF21535_high_6
Description: NF21535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21535_high_6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 3239585 - 3239359
Alignment:
| Q |
19 |
acggtttccctaacgttgtcaaatttttgttttgtttaaatatcccnnnnnnn-gtagtattattaattcaattaa-----tcagtaccacacttggcat |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| | |||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
3239585 |
acggtttccctaacgttatcaaatttttggtttgtttaaatatcacatttttttgtagtattgttaattcaattaaattaattagtaccacacttggcat |
3239486 |
T |
 |
| Q |
113 |
tctaaattgcctnnnnnnnnnnnnnnnaccccctttattcaatagttttt-catattttcgtggatcccttcaattcttttctccccctccttctctcct |
211 |
Q |
| |
|
||||||||| || |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239485 |
tctaaattgtcttctctctcttctctcaccc--tttattcaatagttttttcatattttcgtggatcccttcaattcttttctccccctccttctctcct |
3239388 |
T |
 |
| Q |
212 |
tagaaacaaacccttctcttgtattcttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3239387 |
tagaaacaaacccttctcttgtattcttt |
3239359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University