View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21535_low_4 (Length: 318)
Name: NF21535_low_4
Description: NF21535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21535_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 16 - 294
Target Start/End: Original strand, 38882103 - 38882382
Alignment:
| Q |
16 |
aaaacaattaacatacttttcattttatggttaaaaaacaattaaccggtaagaggtgaccttagcgaatacggagagtt-aaagtgaagtgtggttagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
38882103 |
aaaacaattaacatacttttcattttatggttaaaaaacaattaaccggtaagcggtgaccttagcgaatacggagagtttaaagtgaagtgcggttagt |
38882202 |
T |
 |
| Q |
115 |
tagtttagttgttacagttagaaagaaatgaaggcggtaggtattgttgttggtggtgttccaccgctttgttctaatggaattcgtatacgtcagttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38882203 |
tagtttagttgttacagttagaaagaaatgaaggcggtaggtattgttgttggtggtgttccaccgctttgttctaatggaattcgtaaacgtcagttct |
38882302 |
T |
 |
| Q |
215 |
gcgtttcagcctcttcatcgtcgggacccaaaacggtttgcatattttgctattgtttttcgtgtgcgattatgaaattt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38882303 |
gcgtttcagcctcttcatcgtcgggacccaaaacggtttgcatattttgctattgtttttcgtgtgcgattatgaaattt |
38882382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 11049038 - 11049111
Alignment:
| Q |
103 |
agtgtggttagttagtttagttgttacagttagaaagaaatgaaggcggtaggtattgttgttggtggtgttcc |
176 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| ||| |||||||||| | ||||||||| |||||| ||||| |
|
|
| T |
11049038 |
agtgtggttagttagcttagttgttacatataggaagcaatgaaggcgctgagtattgttggtggtggggttcc |
11049111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University