View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21536_high_18 (Length: 209)
Name: NF21536_high_18
Description: NF21536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21536_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 43032267 - 43032467
Alignment:
| Q |
16 |
atacttgagggg-atatcatagagtttaagtttgagtgattaatcccacaatgacatttgatacataaaagagacgacacataatgtttt--------ga |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
43032267 |
atacttgagggggatatcatagagtttaagtttgagtgattaatcccacaatgacatttgatacataaaagagatgacacataatgttttaaggttttga |
43032366 |
T |
|
| Q |
107 |
gtagagatgtgacgtctcannnnnnngtggtcgagctttggctagttgttgctctcgacgctctctatgtcttcccaacaaaatcatttgtaatcgagac |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032367 |
gtagagatgtgacgtctcatttttttgtggtcgagctttggttagttgttgctctcgacgctctctatgtcttcccaacaaaatcatttgtaatcgagac |
43032466 |
T |
|
| Q |
207 |
t |
207 |
Q |
| |
|
| |
|
|
| T |
43032467 |
t |
43032467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University