View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21536_high_9 (Length: 330)
Name: NF21536_high_9
Description: NF21536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21536_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 312
Target Start/End: Complemental strand, 16331203 - 16330907
Alignment:
| Q |
16 |
ataggagaggaagtccacctttggtgatgatgttttctcatcatcattatttatctaacttcattgttatgcctaattttcttcatgctgatactttann |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16331203 |
ataggagaggaagtccacctttggtgatgatgttttctcttcatcattatttatccaacttcattgttatgcctaattttcttcatgctgatactttatt |
16331104 |
T |
 |
| Q |
116 |
nnnnnnnnnncgaagagacatgcaacattaagaatttgcctttaagacggcttgctatgccaaggtgttctccatcaacaattgttaacatcgtttagac |
215 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16331103 |
tttcgtttgtcgaagagacgggcaacattaagaattttcctttaagacggcttgctatgccaaggtgttctccatccacaattgttaacatcgttcagac |
16331004 |
T |
 |
| Q |
216 |
tagggacttggttgagcagctcgtgactttggtttcccttcacgtagaattgctaagattattttctaggtcattggatgacctagacgctgagcag |
312 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16331003 |
tagggacttagttgagcagctcgtgactttggtttcccttcacgtagcattgctgatattattttctaggtcgttggatgacttagacgctgagcag |
16330907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 151 - 303
Target Start/End: Complemental strand, 16340238 - 16340086
Alignment:
| Q |
151 |
ttgcctttaagacggcttgctatgccaaggtgttctccatcaacaattgttaacatcgtttagactagggacttggttgagcagctcgtgactttggttt |
250 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||| || || |||| | || |||| |||||||||| || ||||| || |||||||||||||||| |
|
|
| T |
16340238 |
ttgcctttaagacgtatttccatgccaaggtgttctctatacacgattgatgacgacgttcagactagggatttagttgaacaactcgtgactttggttt |
16340139 |
T |
 |
| Q |
251 |
cccttcacgtagaattgctaagattattttctaggtcattggatgacctagac |
303 |
Q |
| |
|
| || || ||| |||| | |||||||||||||||||||||| |||||||||| |
|
|
| T |
16340138 |
ctctggacatagcattgatgagattattttctaggtcattggttgacctagac |
16340086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University