View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21536_low_12 (Length: 281)
Name: NF21536_low_12
Description: NF21536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21536_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 48 - 158
Target Start/End: Original strand, 27283754 - 27283864
Alignment:
| Q |
48 |
tggaaaatgtggtcaattgtgttcgcggaaaactaaaacttgttgctatcgattttattattgctgattgtctagatatcttgttttgtttattaaatgt |
147 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
27283754 |
tggaaaatgtggttaattgtgtacgcggaaaactcaaacttgtggctattgattttattattgctgattgtctagatatcatgtttagtttgttaaatgt |
27283853 |
T |
 |
| Q |
148 |
tagtaaatttg |
158 |
Q |
| |
|
||||||||||| |
|
|
| T |
27283854 |
tagtaaatttg |
27283864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University