View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21537_high_11 (Length: 283)
Name: NF21537_high_11
Description: NF21537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21537_high_11 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 2 - 283
Target Start/End: Original strand, 7872853 - 7873142
Alignment:
| Q |
2 |
gttaggaattagatttagagactaagatttttgtttggctaccacaaaaatcacttgatgctatttgaacgtgaattttaaaattagtttagaactttca |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7872853 |
gttaggaattagatttagagactgagatttttgtttggctaccacaaaaatcact-gatgctatttgaacgtgaattttaaaattagtttagaactttca |
7872951 |
T |
|
| Q |
102 |
tttttttcagctcaatatgagtttgtttccttga-----nnnnnnnnnnncttccaaaagataacg--tgtttcattgactcctaatttgtcggttaaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7872952 |
tttttttcagctcaatatgagtttgttttcttgattagttttttttttcttttccaaaagataacgtttgtttcattgactcctaatttgtcggttaaat |
7873051 |
T |
|
| Q |
195 |
ttttgtgtacttatacgttacttgattactgcttcttctaataaaaaccctatcaattgaacaaattgagaatag--tagatggtgagttt |
283 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||| ||||||||| |||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
7873052 |
ttttgtgtacttataagttacttgattactgcttcttataatcaaaaccctaacaattgaaaaaattgagcatagtatagatggtgagttt |
7873142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 94 - 135
Target Start/End: Complemental strand, 7475876 - 7475835
Alignment:
| Q |
94 |
aactttcatttttttcagctcaatatgagtttgtttccttga |
135 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
7475876 |
aactttcctttttttaagctcaatatgagtttgtttcattga |
7475835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University