View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21537_high_15 (Length: 246)
Name: NF21537_high_15
Description: NF21537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21537_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 34698522 - 34698760
Alignment:
| Q |
1 |
cttaccaccttcccacacacctttgggatgcacttttaaataaaatgcatcccaggtgcaccaaccgaatttgtcaacgatatttggtggtgttttttct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
34698522 |
cttaacaccttcccacacacctttgggatgcactttcaaataaaatgcatcccaggtgcaccaaccgaatttatcaatgatatttggtggtgttttttct |
34698621 |
T |
 |
| Q |
101 |
tgaagtaacttgaatgttcctaagtgggtccggattactttcattgcttcttttactaaacggtaggggtcattgctgacgtggatgtaaagacatgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698622 |
tgaagtaacttgaatgttcctaagtgggtccggattactttcattgcttcttttactaaacggtaggggtcattgctgacgtggatgtaaagacatgatt |
34698721 |
T |
 |
| Q |
201 |
tgaagtgggactcgaggacatgtgttgaaccactctctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698722 |
tgaagtgggactcgaggacatgtgttgaaccactctctg |
34698760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 101
Target Start/End: Original strand, 43564447 - 43564512
Alignment:
| Q |
36 |
ttaaataaaatgcatcccaggtgcaccaaccgaatttgtcaacgatatttggtggtgttttttctt |
101 |
Q |
| |
|
||||||| || |||||||| ||||||||||| ||||| ||||| | ||||||| ||||||| |||| |
|
|
| T |
43564447 |
ttaaatagaaagcatcccaagtgcaccaaccaaatttatcaactaaatttggtagtgttttctctt |
43564512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University