View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21537_low_13 (Length: 262)
Name: NF21537_low_13
Description: NF21537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21537_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 36 - 246
Target Start/End: Original strand, 19435464 - 19435678
Alignment:
| Q |
36 |
tgtagggcgcgtaagaggcatacaagggggagcaaaaatgagtnnnnnnnnnnnc---ttttgcttatgcaaataaagattaaatatattaatatcatca |
132 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19435464 |
tgtagggcgtgtaagaggcatacaagggggagcaaaaatgagtaagaaaaaaaacaacttttacttatgcaaataaagattaaatatattaatatcatca |
19435563 |
T |
 |
| Q |
133 |
tattatttaaataaaaacaaacaatcttttttat-gaagnnnnnnncaaacaattttcaatttaaagatttggtaaatcataatataaggtcctaacatc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||| |||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19435564 |
tattatttaaataaaaacaaacaatctttttttttgaagaaaaaaacaaacaatctttaatttaaagatttggtaaatcataatataaggtcctaacatc |
19435663 |
T |
 |
| Q |
232 |
attcaccatcttcat |
246 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19435664 |
attcaccatcttcat |
19435678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University