View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21537_low_16 (Length: 227)
Name: NF21537_low_16
Description: NF21537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21537_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 1964943 - 1965162
Alignment:
| Q |
5 |
caactagttgctcctacacagttaaatggggttaccattggcattgccttggatggttgtaattcaacacctcgtttggctaaggcgtcgtcacaagtgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1964943 |
caactagttgctcctacacagttaaatggggttaccattggcattgccttggatggttgtaattcaacacctcgttttgctaaggcgtcgtcacaagtgt |
1965042 |
T |
|
| Q |
105 |
ttagaagagcagaagagaaaatcattcaattagatgctgctaacaagaagagccagcatcaaagatgtatgacattaacttctggtgtagatgaaagaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965043 |
ttagaagagcagaagagaaaatcattcaattagatgctgctaac---aagagccagcatcaaagatgtatgacattaacttctggtgtagatgaaagaaa |
1965139 |
T |
|
| Q |
205 |
gccaataatgagtagaatactca |
227 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
1965140 |
gccagtaatgagtagaatactca |
1965162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University