View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21538_high_12 (Length: 392)
Name: NF21538_high_12
Description: NF21538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21538_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 22 - 384
Target Start/End: Original strand, 37220464 - 37220827
Alignment:
| Q |
22 |
aagttcggttttcttttttacatcatcccaattgccctctccatattttctcacgtattcttttaatattgcatcctcttgcaatgaccatgctcctttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37220464 |
aagttcggttttcttttttacatcatcccaattgccctctccatattttctcacgtattcttttaatattgcatcctcgtgcaatgaccatgctcctttc |
37220563 |
T |
 |
| Q |
122 |
ttcaactttatagtatcactgccattagaatttgacatgattacttacggaaggatgagaggatggaaattgttctatttataataggatttataaagta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37220564 |
ttcaactttatagtatcactgccattagaatttgacatgattacttacggaaggatgagaggatggaaattgttgtatttataataggatttataaagta |
37220663 |
T |
 |
| Q |
222 |
gttagaggtaaatacggagagtttttgttacttcactt-nnnnnnnntattgttgttacaatatactactagctgaatatcaaagatctaaaagataaag |
320 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220664 |
gttagaggtaaatacggagagtttttgtaacttcacttaaaaaaatatattgttgttacaatatactactagctgaatatcaaagatctaaaagataaag |
37220763 |
T |
 |
| Q |
321 |
ttgcaaccagctgaatatatcaaagatttaaaagataaagttcaatttgttcgcctttcatctc |
384 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220764 |
ttgaaaccagctgaatatatcaaagatttaaaagataaagttcaatttgttcgcctttcatctc |
37220827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University